Detail of EST/Unigene EH664863 |
Acc. | EH664863 |
Internal Acc. | 15F01 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=3e-25; Farnesyl pyrophosphate synthase 1 OS=Parthenium argentatum E-value=4e-25; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=7e-25; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=3e-24; Farnesyl pyrophosphate synthase 2 OS=Arabidopsis thaliana E-value=4e-24; |
Length | 863 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_TT (1 ESTs); |
Sequence | CTTCTCTGCAAATTAACCAACACACACACACACACTCTCTCTGAAACAATAGAGCGATCT |
EST members of Unigene | EH664863 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827430 |
Trichome-related Gene from Literature | 827430 |