Detail of EST/Unigene EH665415 |
Acc. | EH665415 |
Internal Acc. | 22A02 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=1e-80; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=1e-80; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=6e-75; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-74; Glutamate--cysteine ligase A, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-74; |
Length | 971 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_TT (1 ESTs); |
Sequence | TTAAAGCTGTTGCAGAGGAAATGGGAATTGGATTCTTAGGAACTGGATTCCAGCCAAAGT |
EST members of Unigene | EH665415 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |