| Detail of EST/Unigene EH665415 |
| Acc. | EH665415 |
| Internal Acc. | 22A02 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=1e-80; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=1e-80; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=6e-75; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-74; Glutamate--cysteine ligase A, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-74; |
| Length | 971 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_TT (1 ESTs); |
| Sequence | TTAAAGCTGTTGCAGAGGAAATGGGAATTGGATTCTTAGGAACTGGATTCCAGCCAAAGT |
| EST members of Unigene | EH665415 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |