Detail of EST/Unigene EL610125 |
Acc. | EL610125 |
Internal Acc. | mfcor3C12 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Early light-induced protein, chloroplastic OS=Pisum sativum E-value=9e-58; Desiccation stress protein DSP-22, chloroplastic OS=Craterostigma plantagineum E-value=3e-38; High molecular mass early light-inducible protein HV58, chloroplastic OS=Hordeum vulgare E-value=8e-33; Low molecular mass early light-inducible protein HV60, chloroplastic OS=Hordeum vulgare E-value=3e-29; Low molecular mass early light-inducible protein HV90, chloroplastic OS=Hordeum vulgare E-value=4e-29; |
Length | 476 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_FAL_SSH (1 ESTs); |
Sequence | ACATGCCTAGCTTCAGAAGGAATGCTATCTTGAAAGTTCGATCCATGGCTGAGGATGAGC |
EST members of Unigene | EL610125 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.888.1.S1_s_at
|
Corresponding NCBI Gene | 821855 |
Trichome-related Gene from Literature | N/A |