Detail of EST/Unigene EL610287 |
Acc. | EL610287 |
Internal Acc. | mfcor10F2 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Early light-induced protein, chloroplastic OS=Pisum sativum E-value=4e-61; Desiccation stress protein DSP-22, chloroplastic OS=Craterostigma plantagineum E-value=7e-37; High molecular mass early light-inducible protein HV58, chloroplastic OS=Hordeum vulgare E-value=2e-32; Low molecular mass early light-inducible protein HV60, chloroplastic OS=Hordeum vulgare E-value=5e-30; Low molecular mass early light-inducible protein HV90, chloroplastic OS=Hordeum vulgare E-value=6e-30; |
Length | 482 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_FAL_SSH (1 ESTs); |
Sequence | ACCCCTAACATATTCTGTAAAAGCCAAAGCAATCAAACCCAACATAGCAATTCTACCATT |
EST members of Unigene | EL610287 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.888.1.S1_s_at
|
Corresponding NCBI Gene | 821855 |
Trichome-related Gene from Literature | N/A |