| Detail of EST/Unigene ES612889 |
| Acc. | ES612889 |
| Internal Acc. | MTGland_A025_2007-05-07/MTGlandA025_H01_001_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit c, chloroplastic OS=Zygnema circumcarinatum E-value=6e-11; ATP synthase subunit c, chloroplastic OS=Triticum aestivum E-value=6e-11; ATP synthase subunit c, chloroplastic OS=Welwitschia mirabilis E-value=6e-11; ATP synthase subunit c, chloroplastic OS=Vitis vinifera E-value=6e-11; ATP synthase subunit c, chloroplastic OS=Trachelium caeruleum E-value=6e-11; |
| Length | 113 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_TRI; |
| Sequence | ACAAGATAAGGGGTACTTTATTACTTAGTCTGGCTTTTATGGAAGCTTTAACTATTTATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |