| Detail of EST/Unigene ES613764 |
| Acc. | ES613764 |
| Internal Acc. | MTGland_B014_2007-05-07/MTGlandB014_C12_046_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=7e-60; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-58; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=4e-58; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=1e-56; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=2e-55; |
| Length | 648 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_TRI; |
| Sequence | GTAATTCATATCCACCCAATAATGGTGTTTTCACTGACCAAGCAAAACCATACATACAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824891 |
| Trichome-related Gene from Literature | N/A |