Detail of EST/Unigene ES613764 |
Acc. | ES613764 |
Internal Acc. | MTGland_B014_2007-05-07/MTGlandB014_C12_046_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=7e-60; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-58; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=4e-58; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=1e-56; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=2e-55; |
Length | 648 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_TRI; |
Sequence | GTAATTCATATCCACCCAATAATGGTGTTTTCACTGACCAAGCAAAACCATACATACAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824891 |
Trichome-related Gene from Literature | N/A |