Detail of EST/Unigene ES890474 |
Acc. | ES890474 |
Internal Acc. | LET011F7_2005-09-27_1/LET011F7_F08_1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=3e-86; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=2e-65; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=6e-64; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=1e-55; Glutathione S-transferase F2 OS=Arabidopsis thaliana E-value=5e-54; |
Length | 557 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_TRI (1 ESTs); |
Sequence | GATCAAGGTTCATGGCCCTATGATGTCCCCTGCTGTTATGAGAGTCGTAGCTACACTCAA |
EST members of Unigene | ES890474 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819386 |
Trichome-related Gene from Literature | 819386 |