| Detail of EST/Unigene ES891320 |
| Acc. | ES891320 |
| Internal Acc. | LET027F7_2005-10-03_1/LET027F7_B02_1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-20; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=2e-19; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=4e-19; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=1e-18; Amorpha-4,11-diene C-12 oxidase OS=Artemisia annua E-value=2e-18; |
| Length | 382 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_TRI (1 ESTs); |
| Sequence | GCCTAACTCTTATACCATGGCTTTATTTTGGACCACATTTTCAATAGGTTTAGCTCTTCT |
| EST members of Unigene | ES891320 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830693 |
| Trichome-related Gene from Literature | 830693 |