Detail of EST/Unigene ES896862 |
Acc. | ES896862 |
Internal Acc. | LET109_2007-04-25/LET109_F08_027_1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Solanum tuberosum E-value=3e-45; Cysteine synthase OS=Citrullus lanatus E-value=2e-40; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=1e-38; Cysteine synthase OS=Spinacia oleracea E-value=8e-38; Cysteine synthase OS=Zea mays E-value=1e-37; |
Length | 535 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_TRI (1 ESTs); |
Sequence | GGANGCACAATAACAGGTTCAGGCAAGTATTTGAGAGAGCAGAACCCCAACATCAAGCTG |
EST members of Unigene | ES896862 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827145 |
Trichome-related Gene from Literature | 827145 |