| Detail of EST/Unigene EV254795 |
| Acc. | EV254795 |
| Internal Acc. | MTYCD41TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=1e-38; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-37; Ferredoxin-6, chloroplastic OS=Zea mays E-value=5e-33; Ferredoxin, root R-B1 OS=Raphanus sativus E-value=9e-33; Ferredoxin, root R-B2 OS=Raphanus sativus E-value=2e-32; |
| Length | 731 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GGTTTGGCACTTTCCTTCTCTCCTTTTCTCGTGACTTCCTCCACAGCGCTCTCCGACAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817297 |
| Trichome-related Gene from Literature | N/A |