Detail of EST/Unigene EV254820 |
Acc. | EV254820 |
Internal Acc. | MTYCD67TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L16, chloroplastic OS=Glycine max E-value=7e-55; 50S ribosomal protein L16, chloroplastic OS=Cicer arietinum E-value=2e-54; 50S ribosomal protein L16, chloroplastic (Fragment) OS=Vigna unguiculata E-value=2e-54; 50S ribosomal protein L16, chloroplastic OS=Phaseolus angularis E-value=4e-54; 50S ribosomal protein L16, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=4e-54; |
Length | 679 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | ACAACATCGAGGAAGAATGAAAGGAAAAGCCTATCGAGGTAATACAATTTCCTTCGGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |