Detail of EST/Unigene EV254828 |
Acc. | EV254828 |
Internal Acc. | MTYCD76TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=0; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=0; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=0; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Probable ketol-acid reductoisomerase, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-22; |
Length | 775 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGTGCTGGAATTAATTCCAGGTTTGCTGTCCACCAGGATGTGGATGGCAGGGCTACTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825030 |
Trichome-related Gene from Literature | N/A |