Detail of EST/Unigene EV254861 |
Acc. | EV254861 |
Internal Acc. | MTYCE14TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=2e-69; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=1e-66; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=2e-66; Glucan endo-1,3-beta-glucosidase (Fragment) OS=Glycine max E-value=4e-66; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=1e-65; |
Length | 820 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GATATCATAGCTGCATACTTGGTTTATACTTTGGTATAATTAAAGCAATACATTCTTAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |