| Detail of EST/Unigene EV255018 |
| Acc. | EV255018 |
| Internal Acc. | MTYCF90TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase small chain OS=Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1) E-value=3e-37; Carbamoyl-phosphate synthase small chain OS=Synechococcus elongatus (strain PCC 7942) E-value=3e-37; Carbamoyl-phosphate synthase small chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=6e-37; Carbamoyl-phosphate synthase small chain OS=Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) E-value=3e-35; Carbamoyl-phosphate synthase small chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=4e-35; |
| Length | 873 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GGAACCAGCCCCACCCCGCGCTTCTTCTGTTAATCACCGAATCCTCTGTTAATCACCCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
| EC | 2.1.3.2 3.5.2.3 6.3.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822396 |
| Trichome-related Gene from Literature | N/A |