| Detail of EST/Unigene EV255413 |
| Acc. | EV255413 |
| Internal Acc. | MTYCK55TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=3e-98; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=4e-96; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=2e-45; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=3e-30; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=6e-30; |
| Length | 747 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | CAACAACATCGTCGTCGAAGCGAGGTGGAGGAGGAGGAAGATCAAAAATCGTTCAAACAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829344 |
| Trichome-related Gene from Literature | N/A |