Detail of EST/Unigene EV255470 |
Acc. | EV255470 |
Internal Acc. | MTYCL20TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoside-diphosphate reductase small chain A OS=Arabidopsis thaliana E-value=2e-82; Ribonucleoside-diphosphate reductase small chain OS=Nicotiana tabacum E-value=1e-71; Putative ribonucleoside-diphosphate reductase small chain B OS=Arabidopsis thaliana E-value=3e-71; Ribonucleoside-diphosphate reductase small chain C OS=Arabidopsis thaliana E-value=7e-71; Ribonucleoside-diphosphate reductase subunit M2 OS=Rattus norvegicus E-value=1e-67; |
Length | 768 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GATCCAACATCTCTCTTTGGTAACAAGCAACTTGTACCTCTCTGTTTCGGATAACAGAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2 |
EC | 1.17.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821937 |
Trichome-related Gene from Literature | N/A |