| Detail of EST/Unigene EV255618 |
| Acc. | EV255618 |
| Internal Acc. | MTYCM86TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=3e-90; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=7e-82; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=4e-77; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=4e-76; Beta-1,3-galactosyltransferase 15 OS=Arabidopsis thaliana E-value=1e-37; |
| Length | 597 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | TCCTTTTGCAGAGGGTAGAATGTTTGTCCTTACACTGCGGGCTGGTGTTGATGGATACCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko00532 Chondroitin sulfate biosynthesis > K00734 galactosylxylosylprotein 3-beta-galactosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K00734 galactosylxylosylprotein 3-beta-galactosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko01031 Glycan structures - Biosynthesis 2 > K07819 beta-1,3-galactosyltransferase 1; Metabolism > Glycan Biosynthesis and Metabolism > ko00601 Glycosphingolipid biosynthesis - lacto and neolacto series > K07819 beta-1,3-galactosyltransferase 1 |
| EC | 2.4.1.- 2.4.1.134 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827853 |
| Trichome-related Gene from Literature | N/A |