Detail of EST/Unigene EV255706 |
Acc. | EV255706 |
Internal Acc. | MTYCN90TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 14 OS=Arabidopsis thaliana E-value=2e-64; Probable beta-1,3-galactosyltransferase 13 OS=Arabidopsis thaliana E-value=4e-63; Probable beta-1,3-galactosyltransferase 12 OS=Arabidopsis thaliana E-value=2e-51; Probable beta-1,3-galactosyltransferase 5 OS=Arabidopsis thaliana E-value=5e-22; Beta-1,3-galactosyltransferase 7 OS=Arabidopsis thaliana E-value=5e-21; |
Length | 793 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGTGGACACGGCAAAGAAAGAGGCACGCCAAAAGCTAGATTAGTCTTGTTAATGTCCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.4.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841763 |
Trichome-related Gene from Literature | N/A |