Detail of EST/Unigene EV255752 |
Acc. | EV255752 |
Internal Acc. | MTYCO45TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP-dependent zinc metalloprotease FTSH 10, mitochondrial OS=Arabidopsis thaliana E-value=2e-52; ATP-dependent zinc metalloprotease FTSH 3, mitochondrial OS=Oryza sativa subsp. japonica E-value=3e-50; ATP-dependent zinc metalloprotease FTSH 8, mitochondrial OS=Oryza sativa subsp. japonica E-value=5e-50; ATP-dependent zinc metalloprotease FTSH 3, mitochondrial OS=Arabidopsis thaliana E-value=3e-49; AFG3-like protein 2 OS=Mus musculus E-value=5e-31; |
Length | 330 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GCTGTTGCAGGTTGGTTCTTGGAACATTGTGAGCCATTGTTGAAAGTAACCATTGTTCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.24.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837265 |
Trichome-related Gene from Literature | N/A |