Detail of EST/Unigene EV255826 |
Acc. | EV255826 |
Internal Acc. | MTYCP29TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | PsbP-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-67; PsbP-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-27; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=1e-05; Oxygen-evolving enhancer protein 2-3, chloroplastic OS=Nicotiana tabacum E-value=1e-05; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-05; |
Length | 772 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAGCACAAGGTCTAAATTCTACTTACTATCCACTCAGTATTTCTTTCCATCTCAAAACTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818532 |
Trichome-related Gene from Literature | N/A |