| Detail of EST/Unigene EV255941 |
| Acc. | EV255941 |
| Internal Acc. | MTYCQ69TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Pongo abelii E-value=4e-09; N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Mus musculus E-value=4e-09; N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Homo sapiens E-value=4e-09; N-alpha-acetyltransferase 16, NatA auxiliary subunit OS=Homo sapiens E-value=3e-08; N-alpha-acetyltransferase 16, NatA auxiliary subunit OS=Mus musculus E-value=5e-07; |
| Length | 292 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | CATGGATCGTAAGTCTGAAGCATATGAACTTGTTCGTCAAGGATTGAAGAATGACCTTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.3.1.88 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844381 |
| Trichome-related Gene from Literature | N/A |