Detail of EST/Unigene EV256016 |
Acc. | EV256016 |
Internal Acc. | MTYCR65TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L9, chloroplastic OS=Pisum sativum E-value=1e-24; 50S ribosomal protein L9, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; 50S ribosomal protein L9, chloroplastic OS=Ipomoea trifida E-value=1e-17; 50S ribosomal protein L9, chloroplastic OS=Triticum aestivum E-value=3e-14; |
Length | 360 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | TAACTTGAACACTTCTTCTCAATCTTCCAACAAAACTTCAAGGTTCTTAATTTTCGCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823623 |
Trichome-related Gene from Literature | N/A |