| Detail of EST/Unigene EV256016 |
| Acc. | EV256016 |
| Internal Acc. | MTYCR65TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L9, chloroplastic OS=Pisum sativum E-value=1e-24; 50S ribosomal protein L9, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; 50S ribosomal protein L9, chloroplastic OS=Ipomoea trifida E-value=1e-17; 50S ribosomal protein L9, chloroplastic OS=Triticum aestivum E-value=3e-14; |
| Length | 360 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | TAACTTGAACACTTCTTCTCAATCTTCCAACAAAACTTCAAGGTTCTTAATTTTCGCTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823623 |
| Trichome-related Gene from Literature | N/A |