| Detail of EST/Unigene EV256077 |
| Acc. | EV256077 |
| Internal Acc. | MTYCS42TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphatase IMPL1, chloroplastic OS=Arabidopsis thaliana E-value=2e-78; Inositol-1-monophosphatase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=1e-23; Inositol monophosphatase 3 OS=Solanum lycopersicum E-value=7e-21; Inositol monophosphatase 2 OS=Solanum lycopersicum E-value=9e-21; Inositol monophosphatase 1 OS=Solanum lycopersicum E-value=8e-20; |
| Length | 679 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | TACAAAACTATTTCCTCCTACTACTTACCGCCTTCAAAGTCAAACCTCTCGAAGTTGGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01092 myo-inositol-1(or 4)-monophosphatase; Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01092 myo-inositol-1(or 4)-monophosphatase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K01092 myo-inositol-1(or 4)-monophosphatase |
| EC | 3.1.3.25 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840007 |
| Trichome-related Gene from Literature | N/A |