| Detail of EST/Unigene EV256205 |
| Acc. | EV256205 |
| Internal Acc. | MTYCU17TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 46 OS=Arabidopsis thaliana E-value=4e-78; Beta-glucosidase 45 OS=Arabidopsis thaliana E-value=8e-76; Beta-glucosidase 47 OS=Arabidopsis thaliana E-value=2e-68; Probable inactive beta-glucosidase 14 OS=Oryza sativa subsp. japonica E-value=4e-67; Beta-glucosidase 18 OS=Oryza sativa subsp. japonica E-value=1e-63; |
| Length | 818 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GCAAGGAGGACAAATTGGCATTGTCGTACACGTTGACTGGTTTGAACCATATAGCAATTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842479 |
| Trichome-related Gene from Literature | N/A |