Detail of EST/Unigene EV256298 |
Acc. | EV256298 |
Internal Acc. | MTYCV28TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Presenilin-like protein At2g29900 OS=Arabidopsis thaliana E-value=1e-59; Presenilin-like protein At1g08700 OS=Arabidopsis thaliana E-value=9e-44; Presenilin-A OS=Dictyostelium discoideum E-value=2e-18; Presenilin-B OS=Dictyostelium discoideum E-value=5e-15; Presenilin homolog OS=Drosophila melanogaster E-value=1e-12; |
Length | 730 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | AGAAACCCGAAGAACTTCATCATCTTCAACAACCGTTCTCGATAGTTTAGGCGAAGAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04505 presenilin 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04505 presenilin 1; Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K06060 presenilin, invertebrate |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.5 Polycystin cation channel PCC |
Probeset |
|
Corresponding NCBI Gene | 817540 |
Trichome-related Gene from Literature | N/A |