| Detail of EST/Unigene EV256328 |
| Acc. | EV256328 |
| Internal Acc. | MTYCV60TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phospholipid hydroperoxide glutathione peroxidase, chloroplastic OS=Pisum sativum E-value=2e-97; Phospholipid hydroperoxide glutathione peroxidase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-74; Putative glutathione peroxidase 7, chloroplastic OS=Arabidopsis thaliana E-value=6e-71; Probable phospholipid hydroperoxide glutathione peroxidase OS=Mesembryanthemum crystallinum E-value=6e-57; Probable phospholipid hydroperoxide glutathione peroxidase OS=Citrus sinensis E-value=2e-56; |
| Length | 719 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | AGTCTCTGCAGTTGTGATTGTGAACAACGCAAAATGGTTTCCATGGCTTCTTCCGCAACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
| EC | 1.11.1.12 1.11.1.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817046 |
| Trichome-related Gene from Literature | N/A |