Detail of EST/Unigene EV256328 |
Acc. | EV256328 |
Internal Acc. | MTYCV60TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phospholipid hydroperoxide glutathione peroxidase, chloroplastic OS=Pisum sativum E-value=2e-97; Phospholipid hydroperoxide glutathione peroxidase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-74; Putative glutathione peroxidase 7, chloroplastic OS=Arabidopsis thaliana E-value=6e-71; Probable phospholipid hydroperoxide glutathione peroxidase OS=Mesembryanthemum crystallinum E-value=6e-57; Probable phospholipid hydroperoxide glutathione peroxidase OS=Citrus sinensis E-value=2e-56; |
Length | 719 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | AGTCTCTGCAGTTGTGATTGTGAACAACGCAAAATGGTTTCCATGGCTTCTTCCGCAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.12 1.11.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817046 |
Trichome-related Gene from Literature | N/A |