| Detail of EST/Unigene EV256386 |
| Acc. | EV256386 |
| Internal Acc. | MTYCW31TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,4-xylosyltransferase IRX10L OS=Arabidopsis thaliana E-value=0; Probable glucuronosyltransferase Os01g0926700 OS=Oryza sativa subsp. japonica E-value=0; Probable beta-1,4-xylosyltransferase IRX10 OS=Arabidopsis thaliana E-value=0; Probable glucuronosyltransferase Os02g0520750 OS=Oryza sativa subsp. japonica E-value=0; Probable glucuronosyltransferase Os01g0926600 OS=Oryza sativa subsp. japonica E-value=0; |
| Length | 742 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GAAAGAGGGATTCTTCCGCTGCTGCGGCGTGCTACTTTGGTTCAAACATTTGGACAGAGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2 |
| EC | 2.4.1.- 2.4.1.17 2.4.1.224 2.4.1.225 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836306 |
| Trichome-related Gene from Literature | N/A |