Detail of EST/Unigene EV256417 |
Acc. | EV256417 |
Internal Acc. | MTYCW68TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione synthetase, chloroplastic OS=Arabidopsis thaliana E-value=1e-21; Glutathione synthetase, chloroplastic OS=Solanum lycopersicum E-value=4e-21; Glutathione synthetase, chloroplastic OS=Brassica juncea E-value=3e-20; |
Length | 180 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | TGAAACTCATTGGAAACAAGCTTGTGATTTGTCACCTTTATTCAATGAACTTGTTGATCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 6.3.2.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832797 |
Trichome-related Gene from Literature | 832797 |