| Detail of EST/Unigene EV256417 |
| Acc. | EV256417 |
| Internal Acc. | MTYCW68TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione synthetase, chloroplastic OS=Arabidopsis thaliana E-value=1e-21; Glutathione synthetase, chloroplastic OS=Solanum lycopersicum E-value=4e-21; Glutathione synthetase, chloroplastic OS=Brassica juncea E-value=3e-20; |
| Length | 180 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | TGAAACTCATTGGAAACAAGCTTGTGATTTGTCACCTTTATTCAATGAACTTGTTGATCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 6.3.2.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832797 |
| Trichome-related Gene from Literature | 832797 |