Detail of EST/Unigene EV256577 |
Acc. | EV256577 |
Internal Acc. | MTYCY53TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=5e-78; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=3e-44; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=2e-39; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-37; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=3e-37; |
Length | 866 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGTATTGTGTATACACTGTTTTCAGTTCACTCAGATGAAGTTGGCTTTATAACACCATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829599 |
Trichome-related Gene from Literature | N/A |