Detail of EST/Unigene EV256589 |
Acc. | EV256589 |
Internal Acc. | MTYCY65TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Formimidoyltransferase-cyclodeaminase OS=Sus scrofa E-value=4e-13; Formimidoyltransferase-cyclodeaminase OS=Mus musculus E-value=5e-13; Formimidoyltransferase-cyclodeaminase OS=Rattus norvegicus E-value=6e-13; Formimidoyltransferase-cyclodeaminase OS=Dictyostelium discoideum E-value=1e-12; Formimidoyltransferase-cyclodeaminase OS=Homo sapiens E-value=1e-10; |
Length | 769 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAAGTTATTAGTTTAAGTAACTTTGTGAACACAAGTTGCAGCCGGAGAATTGAAGGATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K01746 formiminotetrahydrofolate cyclodeaminase |
EC | 2.1.2.5 4.3.1.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816615 |
Trichome-related Gene from Literature | N/A |