| Detail of EST/Unigene EV256645 |
| Acc. | EV256645 |
| Internal Acc. | MTYCZ31TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamyl-tRNA reductase 1, chloroplastic OS=Cucumis sativus E-value=1e-62; Glutamyl-tRNA reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-59; Glutamyl-tRNA reductase 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-58; Glutamyl-tRNA reductase 2, chloroplastic OS=Cucumis sativus E-value=9e-50; Glutamyl-tRNA reductase 1, chloroplastic OS=Hordeum vulgare E-value=4e-46; |
| Length | 577 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | TGTTTCAACTAGTTTCTATGGTGCTAAATTGGAACCTTTGTTCCTTAAATGTTGTTCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842198 |
| Trichome-related Gene from Literature | N/A |