| Detail of EST/Unigene EV256726 |
| Acc. | EV256726 |
| Internal Acc. | MTYD021TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein usf OS=Aquifex pyrophilus E-value=8e-19; Putative carboxymethylenebutenolidase OS=Aquifex aeolicus (strain VF5) E-value=1e-15; Putative uncharacterized protein yghX OS=Escherichia coli (strain K12) E-value=7e-12; Carboxymethylenebutenolidase OS=Pseudomonas sp. (strain B13) E-value=2e-10; Carboxymethylenebutenolidase OS=Pseudomonas putida E-value=2e-10; |
| Length | 746 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GGTTGTGAGTAAAAGGAATGCTGAGATTTATAACATCATCATCTGCGCCCAAATTCTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
| EC | 3.1.1.45 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817813 |
| Trichome-related Gene from Literature | N/A |