Detail of EST/Unigene EV256726 |
Acc. | EV256726 |
Internal Acc. | MTYD021TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protein usf OS=Aquifex pyrophilus E-value=8e-19; Putative carboxymethylenebutenolidase OS=Aquifex aeolicus (strain VF5) E-value=1e-15; Putative uncharacterized protein yghX OS=Escherichia coli (strain K12) E-value=7e-12; Carboxymethylenebutenolidase OS=Pseudomonas sp. (strain B13) E-value=2e-10; Carboxymethylenebutenolidase OS=Pseudomonas putida E-value=2e-10; |
Length | 746 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGTTGTGAGTAAAAGGAATGCTGAGATTTATAACATCATCATCTGCGCCCAAATTCTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817813 |
Trichome-related Gene from Literature | N/A |