Detail of EST/Unigene EV256810 |
Acc. | EV256810 |
Internal Acc. | MTYD112TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=9e-96; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=1e-92; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=1e-40; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=1e-26; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=2e-26; |
Length | 773 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAGCGATGGATACATTACCAACAACATCGTCGTCGAAGCGAGGTGGAGGAGGAGGAAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829344 |
Trichome-related Gene from Literature | N/A |