Detail of EST/Unigene EV256856 |
Acc. | EV256856 |
Internal Acc. | MTYD166TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Frataxin, mitochondrial OS=Arabidopsis thaliana E-value=3e-33; Frataxin, mitochondrial OS=Mus musculus E-value=8e-15; Frataxin, mitochondrial OS=Homo sapiens E-value=1e-13; Frataxin, mitochondrial OS=Bos taurus E-value=3e-13; Frataxin homolog, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-13; |
Length | 860 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GCTTCTGATGTGAATCATATTATCTCAGTTCTTCTCCTCTTCTCACTGACGACTCACTCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828013 |
Trichome-related Gene from Literature | N/A |