Detail of EST/Unigene EV257171 |
Acc. | EV257171 |
Internal Acc. | MTYD533TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Tetraketide alpha-pyrone reductase 2 OS=Arabidopsis thaliana E-value=0; Tetraketide alpha-pyrone reductase 1 OS=Arabidopsis thaliana E-value=2e-56; Cinnamoyl-CoA reductase 1 OS=Arabidopsis thaliana E-value=7e-41; Cinnamoyl-CoA reductase 2 OS=Arabidopsis thaliana E-value=3e-40; Dihydroflavonol-4-reductase OS=Callistephus chinensis E-value=1e-39; |
Length | 752 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAATCAGCCAAACATAAAAACAGAAAGAGATGCCTGAGTTTTGCGTCACAGGAGGCACTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
EC | 1.1.1.170 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843183 |
Trichome-related Gene from Literature | N/A |