Detail of EST/Unigene EV257469 |
Acc. | EV257469 |
Internal Acc. | MTYD873TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Tricyclene synthase TPS4, chloroplastic OS=Medicago truncatula E-value=0; Tricyclene synthase EBOS, chloroplastic OS=Lotus japonicus E-value=1e-68; Isoprene synthase, chloroplastic OS=Populus canescens E-value=2e-41; Isoprene synthase, chloroplastic OS=Populus tremuloides E-value=9e-41; Isoprene synthase, chloroplastic OS=Populus alba E-value=9e-41; |
Length | 762 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAATGCAAAGAACTCTTCCTTATTCTCTCACTTGCAAAGAACTCTTCCTTTATATCACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832461 |
Trichome-related Gene from Literature | N/A |