| Detail of EST/Unigene EV257505 |
| Acc. | EV257505 |
| Internal Acc. | MTYD915TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Malus domestica E-value=7e-97; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Pyrus communis E-value=2e-96; Dihydroflavonol-4-reductase OS=Vitis vinifera E-value=7e-94; Dihydroflavonol-4-reductase (Fragment) OS=Medicago sativa E-value=2e-93; Dihydroflavonol-4-reductase OS=Dianthus caryophyllus E-value=2e-90; |
| Length | 738 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GAGCTCAGGTTTCTCTTCATTCCTCTCTCTTTACAACAGCTTCTTTCTAAATAAATAGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
| EC | 1.1.1.- 1.1.1.145 1.1.1.170 5.3.3.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834291 |
| Trichome-related Gene from Literature | 834291 |