Detail of EST/Unigene EV257584 |
Acc. | EV257584 |
Internal Acc. | MTYDA12TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase zeta class OS=Euphorbia esula E-value=3e-64; Glutathione S-transferase Z2 OS=Arabidopsis thaliana E-value=1e-58; Glutathione S-transferase Z1 OS=Arabidopsis thaliana E-value=3e-55; Glutathione S-transferase 1 OS=Dianthus caryophyllus E-value=6e-55; Glutathione S-transferase OS=Triticum aestivum E-value=1e-41; |
Length | 774 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAAGAAAAAGAAAAGGAAAAAAAAAACACGAACCCACTACTCCTCCTTCCCTCCCTAGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
EC | 2.5.1.18 5.2.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 814769 |
Trichome-related Gene from Literature | N/A |