Detail of EST/Unigene EV257649 |
Acc. | EV257649 |
Internal Acc. | MTYDA92TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S4, chloroplastic OS=Lotus japonicus E-value=7e-79; 30S ribosomal protein S4, chloroplastic OS=Glycine max E-value=2e-78; 30S ribosomal protein S4, chloroplastic OS=Phaseolus vulgaris E-value=1e-77; 30S ribosomal protein S4, chloroplastic OS=Coffea arabica E-value=4e-77; 30S ribosomal protein S4, chloroplastic OS=Populus trichocarpa E-value=2e-76; |
Length | 664 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GTATTCGTTTAGAAGAAAAACAAAAATTGCGTTTTCATTATGGTCTTACAGAACGACAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |