| Detail of EST/Unigene EV257649 |
| Acc. | EV257649 |
| Internal Acc. | MTYDA92TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S4, chloroplastic OS=Lotus japonicus E-value=7e-79; 30S ribosomal protein S4, chloroplastic OS=Glycine max E-value=2e-78; 30S ribosomal protein S4, chloroplastic OS=Phaseolus vulgaris E-value=1e-77; 30S ribosomal protein S4, chloroplastic OS=Coffea arabica E-value=4e-77; 30S ribosomal protein S4, chloroplastic OS=Populus trichocarpa E-value=2e-76; |
| Length | 664 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GTATTCGTTTAGAAGAAAAACAAAAATTGCGTTTTCATTATGGTCTTACAGAACGACAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |