| Detail of EST/Unigene EV257838 |
| Acc. | EV257838 |
| Internal Acc. | MTYDD35TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thermospermine synthase ACAULIS5 OS=Arabidopsis thaliana E-value=4e-86; Probable spermidine synthase OS=Sulfolobus tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7) E-value=6e-38; Probable spermidine synthase OS=Sulfolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2) E-value=4e-37; Probable spermidine synthase OS=Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1) E-value=2e-36; Probable spermidine synthase OS=Sulfolobus islandicus (strain M.14.25 / Kamchatka #1) E-value=2e-36; |
| Length | 653 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | TCAACAAATAAAACCATGGGAGAGGCACCAGAAATGTTTTACGTTAACGGGTTTGCAAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
| EC | 2.5.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832073 |
| Trichome-related Gene from Literature | N/A |