Detail of EST/Unigene EV257955 |
Acc. | EV257955 |
Internal Acc. | MTYDE73TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastocyanin, chloroplastic OS=Pisum sativum E-value=3e-62; Plastocyanin, chloroplastic OS=Solanum lycopersicum E-value=1e-48; Plastocyanin, chloroplastic OS=Spinacia oleracea E-value=6e-48; Plastocyanin, chloroplastic OS=Silene pratensis E-value=8e-48; Plastocyanin A, chloroplastic OS=Populus nigra E-value=2e-46; |
Length | 643 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | ACCGTTACTTCCACCACCGTTGCTATTCTATCATTCACAGGCCTTAAGGCAAACGCAAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838622 |
Trichome-related Gene from Literature | N/A |