Detail of EST/Unigene EV258093 |
Acc. | EV258093 |
Internal Acc. | MTYDG38TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=0; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=4e-88; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=1e-87; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-86; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=2e-86; |
Length | 682 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | ATGGAGAAGCTGCCAATGTCTTTGGAAAGGCAAAGACAAACACAGACTTTTTGCCATACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837178 |
Trichome-related Gene from Literature | N/A |