Detail of EST/Unigene EV258333 |
Acc. | EV258333 |
Internal Acc. | MTYDJ11TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L12, chloroplastic OS=Nicotiana tabacum E-value=3e-23; 50S ribosomal protein L12, chloroplastic OS=Nicotiana sylvestris E-value=3e-23; 50S ribosomal protein L12, chloroplastic OS=Spinacia oleracea E-value=6e-22; 50S ribosomal protein L12-3, chloroplastic OS=Arabidopsis thaliana E-value=1e-20; 50S ribosomal protein L12-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-20; |
Length | 363 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | AAGTTCCCAGTAACGCGAGAATTGCAGCGATTAAAGCGGTTAGAGCTTTAACGAGTTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822403 |
Trichome-related Gene from Literature | N/A |