| Detail of EST/Unigene EV258372 |
| Acc. | EV258372 |
| Internal Acc. | MTYDJ58TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Ts, mitochondrial OS=Ricinus communis E-value=3e-89; Elongation factor Ts, mitochondrial OS=Arabidopsis thaliana E-value=4e-89; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. japonica E-value=6e-81; Elongation factor Ts, mitochondrial OS=Zea mays E-value=7e-80; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. indica E-value=1e-79; |
| Length | 815 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GACATACACCTTTCTCTGTCATCTCCATCACTCGCCGCCATGGGTTTAAGCGGAGTAGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826713 |
| Trichome-related Gene from Literature | N/A |