Detail of EST/Unigene EV258372 |
Acc. | EV258372 |
Internal Acc. | MTYDJ58TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Ts, mitochondrial OS=Ricinus communis E-value=3e-89; Elongation factor Ts, mitochondrial OS=Arabidopsis thaliana E-value=4e-89; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. japonica E-value=6e-81; Elongation factor Ts, mitochondrial OS=Zea mays E-value=7e-80; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. indica E-value=1e-79; |
Length | 815 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GACATACACCTTTCTCTGTCATCTCCATCACTCGCCGCCATGGGTTTAAGCGGAGTAGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826713 |
Trichome-related Gene from Literature | N/A |