Detail of EST/Unigene EV258453 |
Acc. | EV258453 |
Internal Acc. | MTYDK53TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 5 OS=Arabidopsis thaliana E-value=2e-51; Glucan endo-1,3-beta-glucosidase 6 OS=Arabidopsis thaliana E-value=7e-45; Glucan endo-1,3-beta-glucosidase 8 OS=Arabidopsis thaliana E-value=7e-33; Glucan endo-1,3-beta-glucosidase 9 OS=Arabidopsis thaliana E-value=4e-26; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=9e-13; |
Length | 580 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | AGCATTCAACCGGGCAACTTTGAACGTCATTGGGGATTGTTTTACTACGATGGACGACCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829242 |
Trichome-related Gene from Literature | N/A |