| Detail of EST/Unigene EV258524 |
| Acc. | EV258524 |
| Internal Acc. | MTYDL34TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L2, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-27; 60S ribosomal protein L2, mitochondrial OS=Oryza sativa subsp. indica E-value=1e-27; 60S ribosomal protein L2, mitochondrial OS=Oryza sativa E-value=1e-27; 60S ribosomal protein L2, mitochondrial OS=Arabidopsis thaliana E-value=1e-18; 60S ribosomal protein L2, mitochondrial OS=Marchantia polymorpha E-value=2e-16; |
| Length | 611 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GCATCACCTCCTTCCACCGCGGCGGCGGCCATAAACGTTTACATCGAGTCATCGATCTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |