Detail of EST/Unigene EV258619 |
Acc. | EV258619 |
Internal Acc. | MTYDM45TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=7e-23; 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=2e-22; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=5e-22; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-21; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=7e-21; |
Length | 669 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | TCATTGTTTTCATCTTCCATCAACACTGTCAAATGTCTACGTTCCAAAAACTCCTCATTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 5.2.1.8 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842294 |
Trichome-related Gene from Literature | N/A |