Detail of EST/Unigene EV258628 |
Acc. | EV258628 |
Internal Acc. | MTYDM54TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acyl carrier protein 1, chloroplastic OS=Casuarina glauca E-value=7e-30; Acyl carrier protein 1, chloroplastic OS=Cuphea lanceolata E-value=3e-27; Acyl carrier protein 4, chloroplastic OS=Cuphea lanceolata E-value=4e-27; Acyl carrier protein 3, chloroplastic OS=Cuphea lanceolata E-value=1e-25; Acyl carrier protein 2, chloroplastic OS=Cuphea lanceolata E-value=1e-24; |
Length | 561 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | TTCCATCACCACAACCTCCATGTCCCTCCTCTCCCTCTCCGACCAATCTATGGTTTCTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841900 |
Trichome-related Gene from Literature | N/A |