Detail of EST/Unigene EV258736 |
Acc. | EV258736 |
Internal Acc. | MTYDN81TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-10; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-09; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=4e-09; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=1e-08; RNA binding protein fox-1 homolog 1-like OS=Danio rerio E-value=1e-08; |
Length | 702 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | AACGTTAGAATCAACCTTAACTGTATTCACACATCAACGTTTCTCAAATAACAACAACTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818107 |
Trichome-related Gene from Literature | N/A |