| Detail of EST/Unigene EV259404 |
| Acc. | EV259404 |
| Internal Acc. | MTYDV63TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerases I, II, and III subunit RPABC5 OS=Arabidopsis thaliana E-value=6e-33; DNA-directed RNA polymerases I, II, and III subunit RPABC5 OS=Brassica napus E-value=7e-32; DNA-directed RNA polymerases I, II, and III subunit RPABC5 OS=Drosophila melanogaster E-value=5e-28; DNA-directed RNA polymerases I, II, and III subunit RPABC5 OS=Mus musculus E-value=8e-28; DNA-directed RNA polymerases I, II, and III subunit RPABC5 OS=Homo sapiens E-value=8e-28; |
| Length | 484 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GATTTCAAGCCAAACGCTAAATATTTGAAAGGTTTCTACTGTTGTGCGGCGTGAGCAGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Transcription > ko03020 RNA polymerase > K03007 DNA-directed RNA Polymerase II subunit L |
| EC | 2.7.7.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842467 |
| Trichome-related Gene from Literature | N/A |